week 7 blog reflection
This week we discussed on a paper which examined the efficiency of primers in regards to metabarcoding the results for environmental DNA. Most discussed in the group was the dynamic of the paper which compared primers which targeted CO1 (mitochondrial cyotochrome c oxidase subunit 1), to those which targeted 12s. The paper seemed to show that 12s primers seemed to work better for fish. For me, this was interesting, as I had somewhat witnessed a similar phenomenon. I had received eDNA samples which contained primers for 12s as well as CO1, and the 12s primers clustered fair better. This is likely the result of the CO1 primers containing degenerate bases, which the mifish primers do not contain (I believe mifish-U was used ‘GTCGGTAAAACTCGTGCCAGC’). Consequently, CO1 reads did not cluster well with DADA2, and when ran through blast, many of the CO1 clustered read results did not match to an NCBI blast result as well. I have yet to download the BOLD database however, and it may be that CO1 matches better to this. I will hopefully have that running in a week or so.